Journal: eLife

Article Title: Evolutionarily conserved long-chain Acyl-CoA synthetases regulate membrane composition and fluidity

doi: 10.7554/eLife.47733

Figure Lengend Snippet: Loss-of-function mutation in the red-colored proteins and gain-of-function mutations in the green-colored proteins act as paqr-2 mutant suppressors. Note that there are likely two separate fluidity-promoting outputs of PAQR-2 signaling: one output promotes desaturase transcription while the other output regulates incorporation of PUFAs into phospholipids. Several previously showed that many paqr-2 suppressor mutations act by promoting desaturase upregulation, either via either SBP-1::MDT-15 or NHR-49::MDT-15 ( ; ; ; ). In contrast, prior to this work only loss-of-function alleles of fld-1 had so far been identified as paqr-2 mutant suppressors that act as regulators of PUFA incorporation .

Article Snippet: The amplified DNA was then used as template for in vitro transcription (MEGAshortscript T7 high yield transcription kit AM1354 from Promega) to produce the sgRNA ( 5’-taatacgactcactatagggctctaccagggtgttcgccggttttagagctagaaata gcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt-3’ ).

Techniques: Mutagenesis

Journal: eLife

Article Title: Evolutionarily conserved long-chain Acyl-CoA synthetases regulate membrane composition and fluidity

doi: 10.7554/eLife.47733

Figure Lengend Snippet: Loss-of-function mutation in the red-colored proteins and gain-of-function mutations in the green-colored proteins act as paqr-2 mutant suppressors. Note that there are likely two separate fluidity-promoting outputs of PAQR-2 signaling (dashed boxes): one output promotes desaturase transcription while the other output regulates incorporation of PUFAs into phospholipids. Previous studies showed that many paqr-2 suppressor mutations act by promoting desaturase upregulation, either via either SBP-1::MDT-15 or NHR-49::MDT-15 ( ; ; ; ). Loss-of-function alleles of fld-1 and or acs-13 (present work) have so far been identified as paqr-2 mutant suppressors that act as regulators of PUFA levels in phospholipids.

Article Snippet: The amplified DNA was then used as template for in vitro transcription (MEGAshortscript T7 high yield transcription kit AM1354 from Promega) to produce the sgRNA ( 5’-taatacgactcactatagggctctaccagggtgttcgccggttttagagctagaaata gcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttt-3’ ).

Techniques: Mutagenesis

Journal: Methods (San Diego, Calif.)

Article Title: Functional analyses of mammalian virus 5′UTR-derived, small RNAs that regulate virus translation

doi: 10.1016/j.ymeth.2020.02.008

Figure Lengend Snippet:

Article Snippet: Reagent/equipment Supplier Product number 30% (29:1) Acrylamide/Bis Solution Bio-Rad 1610156 Agarose Invitrogen 15510–02 Amersham Imager 680 GE Healthcare 29270769 BenchMark protein standard Invitrogen 10747–012 Biotin-16-UTP (10 mM) Roche 50-100-3411 Cap Analog [m 7 G(5′)ppp(5′)G] Thermo Fisher Scientific AM8050 Dual-Luciferase Reporter Assay System Promega E1910 Dynabeads Protein A Invitrogen 10001D Fetal bovine serum (FBS) Thermo Fisher Scientific 26140079 GeneScreen Plus Hybridization Perkin Elmer NEF987001PK High-Capacity cDNA Reverse Applied Biosystems 4368813 Transcription Kit Lipofectamine 2000 Invitrogen 11668019 20/20n Luminometer Turner Biosystem 2030–002 MEGAscript T7 transcription Kit Life Technologies AM1334 Modified Eagle’s medium (MEM) Thermo Fisher Scientific 11095080 MicroSpin G-25 Columns GE Healthcare 27532501 Mini Trans-Blot Transfer Cell Bio-Rad 1703930 Multigene Mini Personal Thermal Cycler Labnet TC-020–24 Normal rabbit serum Sigma-Aldrich NS01L OneMinute stripping buffer GM Biosciences GM6001 OneTaq Hot Start Quick-Load NEB M0488S Phosphate-buffered saline Sigma-Aldrich 806552 PierceTM ECL Western Blotting Substrate Thermo Fisher Scientific 32106 PMSF Sigma-Aldrich P7626 Protease inhibitor cocktail Sigma-Aldrich P8340 Protein assay Bio-Rad 5000006 QIAquick PCR Purification Kit QIAGEN 28104 RMPI 1640 medium Thermo Fisher Scientific 11875093 RNAse-OUT Invitrogen 10777019 RNeasy Mini Kit QIAGEN 74104 Streptavidin MagneSphere Promega Z5481 Paramagnetic Particles SuperFect Transfection Reagent QIAGEN 301305 TA Cloning Kit Life Technologies K203001 Typhoon FLA 7000 Phosphorlmager GE Healthcare n/a Ultrahyb hybridization buffer Themo Fisher Scientific AM8670 Open in a separate window

Techniques: Reporter Assay, Hybridization, Reverse Transcription, Modification, Stripping Membranes, Saline, Western Blot, Protease Inhibitor, Purification, Transfection, TA Cloning